Universal Primers 27F
Cat.No:PC2461 Solarbio
Storage:Store at -20℃,1 year.
Qty:
Size:
{{cart_num}}
My CartStorage:Store at -20℃,1 year.
Qty:
Size:
Name | Universal primers 27F |
Storage | Store at -20℃,1 year. |
Unit | Piece |
Specification | 250ul(10uM) 1ml(10uM) |
Universal primers
Sequence (5'-3') : AGAGTTTGATCCTGGCTCAG
Concentration: 10uM
Solvent: ddH2O
Tm Value: 55.4
Application: Universal primer for amplification of bacterial 16S (PC2462 universal primer 1492R is the downstream primer for amplification)
Note:Product information may be optimized and upgraded. Please refer to the actual label information for accuracy.
Remark:These protocols are for reference only. Solarbio does not independently validate these methods.
Note:
1. The products are all for scientific research use only. Do not use it for medical, clinical diagnosis or treatment, food and cosmetics, etc. Do not store them in ordinary residential areas.
2. For your safety and health, please wear laboratory clothes, disposable gloves and masks.
3. The experimental results may be affected by many factors, after-sale service is limited to the product itself and does not involve other compensation.
Sorry, there is no experimental images.
Sorry, there is no more information.
Sorry, there is no more information.